EST 1645211 is a singleton


Sequence

>1645211 (1 EST) Length=91 GGGAGACTTGTACTTCGACCAGTTTAATAAGAACACCATGTGGATGTAGTTTTGGTGAATTACCTTATAGATTTAGAGTA TTAGGTAATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1645211: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16452113056544AA917150SMTBCEA000100SKSchistosoma Lambda Zap II


Date: 20:50:15 on Sun 19 Nov 117.