EST 1645212 is a singleton


Sequence

>1645212 (1 EST) Length=183 CCCCTACAGATAATCTTATAAACCGTCATATTGACCTTTTACCTTTAACGAAACCGAGATATCCATATTTATTTTCCAAT CTAGATTCTGAAAACCAGAACGTCACTCGTGACTATTATTAGTTTCTTGAGTTTTTTAATAAACAAACACAAATCCACTG GAATCCTTGCCTAGGAAATTTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1645212: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16452123056545AA917151SMTBCEA0000109SKSchistosoma Lambda Zap II


Date: 13:25:3 on Wed 22 Nov 117.