EST 1645214 is a singleton


Sequence

>1645214 (1 EST) Length=86 AAGGAGGAAAATTTATAGATTTGATAATACATTTTTCTGGCTAACGGGGGGTACCCTTACAGAATTTTCCCGGGTAGTAG TTGGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1645214: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16452143056547AA917153SMTBCEA0000116SKSchistosoma Lambda Zap II


Date: 1:44:4 on Sat 18 Nov 117.