EST 1645217 is a singleton


Sequence

>1645217 (1 EST) Length=104 TGACTACAAGAACCAATATAGAAGACCAACTGGCTTACACGGCTAACTCAACTATGAGATTAAGCGACAGACTCTTTCAG CTTACGACGAAGGTCACACGACAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1645217: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16452173056550AA917156SMTBCEA000122SKSchistosoma Lambda Zap II


Date: 19:54:46 on Sat 18 Nov 117.