EST 1645224 is a singleton


Sequence

>1645224 (1 EST) Length=167 GCTCGACCGCAGCTACTTTAGTGCTGACTCAAAAGCTGGCCGAAAATATCATCTGAGAGTAATATTATCGAAGAGCACAT TCATCAAAGCTAGACGATGGAAGACCTTTCAACTCTACTAGCTGCCGAGATATACTATACCAGGAACAAAGGTATGATAA GGCGTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1645224: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16452243056557AA917163SMTBCEA000135SKSchistosoma Lambda Zap II


Date: 14:23:40 on Sun 19 Nov 117.