EST 1645225 is a singleton


Sequence

>1645225 (1 EST) Length=142 TTGCCAATTTTCCAACTATCGGAAGCCTTATTAGCACCGAAGAAAGTAGTTTTACCAACCTAATGGATACATAAACCAGG ATAAGGGACCAGTAAGGAATTAGTTGTACGACTAGGTTAAGTCAGTCGAATATTCGGTTCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1645225: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16452253056558AA917164SMTBCEA000136SKSchistosoma Lambda Zap II


Date: 19:17:18 on Sun 19 Nov 117.