EST 1645226 is a singleton


Sequence

>1645226 (1 EST) Length=183 CTTCTAGTTAAGGACTGTAGAATAAGCACGCAATATAATAGAGAGTACGTGGGTTTTATAATTTAATTGTTCGAATACGT TCTGGATATTATCATACTTCTTCGTTCGTTCGTTATTTCTTTCAAAAGAGTTGTAATGAACTAAAAACGTATAAGCAATA TTCAACTTAACAACACAAAAAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1645226: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16452263056559AA917165SMTBCEA000139SKSchistosoma Lambda Zap II


Date: 12:58:19 on Sun 19 Nov 117.