EST 1645232 is a singleton


Sequence

>1645232 (1 EST) Length=230 TGAATTATGTTCGGTAATCGCTCTCATATCGCTAATCAACTAGATTCATATGCATGTGCTATGTGTCCGGGTTTCCTACT CCCTGAAAGGTTCTCGATTTTATATAGTTCATTCTTATTAATTGCTAATTTAGTTACGCTGAGCGTATGGACTAAGTTAC TGAGTAAGTATAATTAGAGAAATTATATAGGTAGTGATAATATCGGGACGATATCGGTAGTGACTTATTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1645232: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16452323056730AA917187SMTBCEA000308SKSchistosoma Lambda Zap II cercariae


Date: 11:35:51 on Fri 24 Nov 117.