EST 1645233 is a singleton


Sequence

>1645233 (1 EST) Length=224 TCAGAGCCTGGTTGTGGAGCAGGAAAGGGCGGTGGTGCCGGTGGTTCTATTCGTGAAGCTGGTGGTTCACTAGGCAAGAG GGAAGCCACTTTGAGAAGATGAATACTTCCGACGTTTGCGACTAAACAAAACAGTCGTAGCAGCTCAAGGATGGAAACTG AATCAAGAAACTCTGAGTGTCAAAATGAACGCTTCGAACGCAAGGTCCTAAGCAATTTCAAAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1645233: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16452333056731AA917188SMTBCEA000318SKSchistosoma Lambda Zap II cercariae


Date: 6:24:3 on Tue 16 Jan 118.