EST 1645236 is a singleton


Sequence

>1645236 (1 EST) Length=226 TAAAACGTCAGGTGGTGTATCACTGGTCGCGAGATGCTCAATCACCTCAGTGACTATTGTGATGTCGGTGTATCTGTACG CGGAGTGTATATGCCACCTGCAAAAGCTAAGCAACATATACCCGAAGTACAGATGACAGACCACTGTATTTACGCTCCGA GGCTGCTAAGTAAAGACAGTCGCTTTGGCTAAAAAGAATAGCGTATATAAGAGATTGTTAAGCACG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1645236: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16452363056734AA917191SMTBCEA000332SKSchistosoma Lambda Zap II cercariae


Date: 0:25:35 on Sat 25 Nov 117.