EST 1645237 is a singleton


Sequence

>1645237 (1 EST) Length=210 CCTANAATACAGCAAAAAGAAATTAAAGCTTACTACTAAAGTCAAATCCTACTAAATATAACTTTAAAGCACAGTTAAAG GCNCATTAACAGGAAAAACTTGACAACANCTCGGATGGTCAAACTTCAGTATTAGCACGAACTGAACCAAAACCGTTTGC TAAGGGAAATACTAGGACGATTCACCAAAGCACGTTGTGCATCTAAAGCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1645237: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16452373056735AA917192SMTBCEA000337SKSchistosoma Lambda Zap II cercariae


Date: 11:16:4 on Sun 19 Nov 117.