EST 1645240 is a singleton


Sequence

>1645240 (1 EST) Length=251 TAACAGCATGTTTACGATTATATTTCATGTAGTTGAGCTATCATGTTCAAAAAGATAATGATACAGCGTTTAATGCGTAA AATTCAGGAATGTCATTTCAATTTACTTATCCTTCCTAATCGACGTGTAATGTGTTCATCTACCTCTTTAGACTGTAATA GTCTAATTATCATTAATTGTAAGCACAAATATGCGTTATCTGTATAAGGCATCTCCTGAGATATCTATTAAGCTTCAATA CTCTCGATTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1645240: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16452403056738AA917195SMTBCEA000343SKSchistosoma Lambda Zap II cercariae


Date: 16:0:48 on Fri 17 Nov 117.