EST 1645244 is a singleton


Sequence

>1645244 (1 EST) Length=232 CTCTTTACCAACCNCANNNNNTTCCGGTTTAAACTGGTCGCTGGGTCACGTCTTACGGGTCATCACTACCTCACTACGGC GGGAGTCAATCTGGTCACCTGTCAAATCAATTCCCCAAAATCCAATCAGCTTTCTAAGTCATTCGGACATTCGGATGCCT GGATGACGTTCCTTTTAAGTCAGACTTGGTTTAACGTCAACGGGTTTCCGTCATCGATCCGTACCACATCAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1645244: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16452443056742AA917169SMTBCEA000347SKSchistosoma Lambda Zap II cercariae


Date: 6:46:40 on Tue 21 Nov 117.