EST 1645246 is a singleton


Sequence

>1645246 (1 EST) Length=115 ATTTAAACCCCGTAGAATCGATAGATTTNNTCCCACACACCCAAAGTTTAAAACAATTTAAAGAAATTAAAAGTCGAACA AACGTGTGTGTTGTTGTGTAGGCAACCAAGGAACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1645246: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16452463056744AA917171SMTBCEA000356SKSchistosoma Lambda Zap II cercariae


Date: 1:34:18 on Sat 18 Nov 117.