EST 1645251 is a singleton


Sequence

>1645251 (1 EST) Length=152 TAATTAATCAATTAGTAATTTGATCGATCGATTTAAATGAGTATCTAAGTAAAGCAATTCAATTAAACTACATAAACATA TTTATTTTAAAAAAAAAAAAAACTCGCGGGGGGGGCCTTGTCCAATTCGCCTGTGTGTCGTTTCNNNCGGCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1645251: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16452513056749AA917176SMTBCEA000363SKSchistosoma Lambda Zap II cercariae


Date: 0:38:26 on Thu 23 Nov 117.