EST 1645254 is a singleton


Sequence

>1645254 (1 EST) Length=116 AAGAAGCCTGTGGAGGGTTTCAAGGGAAGAAAAGATTCATAGGGCGTCGATCTAGGTTTTTATACTTCATTTAGAACCAG ATAATATTGAATATACTTTCATGATTATCAGAGGGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1645254: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16452543056752AA917179SMTBCEA000367SKSchistosoma Lambda Zap II cercariae


Date: 2:59:27 on Mon 20 Nov 117.