EST 1645260 is a singleton


Sequence

>1645260 (1 EST) Length=200 GTAGTGGTGTTTATCATTTGCGTTTCTTTATATTTATTTATCATGTGAATATGATTTTGGTTTAATTGTGCTGTTGGTTT GATTGACTTTGTGTGACTGACTCCAACATTTTTTTCCGTAATACTACATTACCGTTTAAATTGTGTGATGCAGGACACAC GAAAACACAACTCCGCCACGCNCNNNCAAAACGCCGAGCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1645260: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16452603056758AA917185SMTBCEA000376SKSchistosoma Lambda Zap II cercariae


Date: 4:36:39 on Thu 23 Nov 117.