EST 1658013 is a singleton


Sequence

>1658013 (1 EST) Length=450 ANNAAAAAAAATTAAGTGTTGTGTGGCTGTCTTTCCGGTTTTGATGTTAACCGGCGTTTGTACGTGCACACATATATAAA CAGACACGGAGTGTAGTGGTGTTAAGAGAGCACAGTTGACTGAGCCTTGTAAAGGTACATCAAAAAGTTGTACTTTTCTT TTTGTGGAAGAAGAACTTGACGCAGAAAGCACCCGGCAAGGAGGCAGGTGACGAGTTTTCAGAGTCCGAACCCACCAGAG GGCTTTTATTCTGAGAGACCTACTTNTTNATCGCTAGCACGAAAGAAACTCAGCGCACCGGGGAGTTTCACGTCGTGGTG GTCGCGGCGGAGAAATAAGAAGCCGACGAGTCGTGCTCTCACTTTGTCTGCCGCGCACTACCGAACATAGTACGGTGTGA CACGCCCACTGCGACTCTTGAAGAGGTCACTTCAATAGAGACACTGGTTN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1658013: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16580133073532AA926396TENS1018T. cruzi epimastigote normalized cDNA Library


Date: 22:8:30 on Sat 18 Nov 117.