EST 1658021 is a singleton


Sequence

>1658021 (1 EST) Length=267 AGTTTCTGTACTATATTCTCTATTTTAAATGTTGGAAGCAGCACCCTGCACGCATGAGGCCGTTGGCACCGCGGCGGCAT GTGTGCAAAAAATATCCAATTATCTGAAGCAACTTGAGGAAATGGGTCTGCAGTACACTCCACTGCATTCATGACGGCAG AGACGTGGAACATATCTTATCACGATAATGTGCTGTAGACATGTGCATGACGGACTGCGACATGTCCGACACTGTAGTCC ACGACGATGTGCGTAGCAGAATCTCGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1658021: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16580213073540AA926404TENS1026T. cruzi epimastigote normalized cDNA Library


Date: 13:21:28 on Wed 22 Nov 117.