EST 1658032 is a singleton


Sequence

>1658032 (1 EST) Length=532 AAATCGGCACGAGGCGGCACGAGGGTCTGGAGCTACTTCCGCGTCNATGCGGGGCTTAATTCCGCCTANCGCGTTGTGGC CATGAGGAGCGGATCACGGTGGGTAAATAACGANCGTGATGACGTGGCTGTGGTTCTCATTGTGCAGCCTGGCGGTGCGC TTCTTCTGTGCTCCCTTCTTATTGACGCAGTTGCATGTAAGCTCGGTGAGCCGCACCTGTTGCCGAGGGCCGCATGATCC AANACGCACTGCCGGAGCAGCGGCGCTTCAAACTTCCTTGTTGTCGGGAGTTCCGGGCATCCTACTCAGGAACCGGCTGT ACTGCTTGTCGAACCACGTANCCGCCTCCGTTGTGTGCCGCTTTGCGTGCGTGCATANGGGGGAGGAATGTNANGCGGGG GAATNCCGGTTGCCAAGGGACATCCCCGTGACTGCNCCTGGAAAAAACAATNAACTGTTCTTTACNAAGAAATTGGCGTT TTTCTCCNCCGGGGGGAAAAATCTCCCCCCCCTTAATCTACCCGCAAAAAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1658032: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16580323073551AA926415TENS1037T. cruzi epimastigote normalized cDNA Library


Date: 0:49:40 on Fri 24 Nov 117.