EST 1658049 is a singleton


Sequence

>1658049 (1 EST) Length=418 ATTCGGCACGAGGCACATATCGATCTATCTTTATCTTTATATATATATATATACATGTACTGCCTGAATTAATGGCTGGC AGCAAAGCGTAAGANCATATGACCATCGCAATTGGGGGGCGCGTCAAAAGCCAGGGCCTATTTAACGCATGAACTATTGG TCACTTTTCTGGTGACGGGATANTTGTTGTTGTTGTTTTTTCTTTTTTTTTTTTTTTTTTTTTTGTTAAAAAAAACAGGA AAAAAAAAAAAAAAACATNTCCATACATNTACACNTTGACTTAACAACTGTCTCATTGTGTGCCNCNCTGTGTNATTNAC TACCTGCTTGTTTCCGGAAAGAGAAAAAAGAAAAAAGAAAAAGGCGGGTCGGCAAAACCNAAATNTTCTACCGAAACNAA AGGAACCCCNGAAGAAAN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1658049: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16580493073568AA926432TENS1054T. cruzi epimastigote normalized cDNA Library


Date: 0:25:22 on Sat 25 Nov 117.