EST 1658055 is a singleton


Sequence

>1658055 (1 EST) Length=550 GANGCCCNAGGGAGGCCCCAATGACATAAAACACNTCTNATACAACTAATACAGAACCTTCGGCATCACATTTTNCACGA TACACTGCAGANATGAAGCCACTCGATACTGCGACCGGGCTACGGCCTACAATAGCTTCCCATCCGGTCGTTCAAATGAA CACNACTCTCAGCAATGANTTGGCCACCCTCCTGAATTTGGCTGCGTGGACTTCGCGACTGCATGCAAGGGCANATGCCG CCCGGGATCTCTTTGTCCATTTGTATGGATCTTCTGAAGCCGAGGTGTTGCTTGCCCAGCAACANTGGCANATGCCCGTG GGGCCCAAAAGGCCATTTCCTTTGCGCTCAGCTGAAGCATCTTCTTTTTCAGAACCTAACCACGATACAATTGGGGACAT TCATANACGTTCTGTCGGTCTGGATCGCTTGGGTGCCCTTAGCAATGGGGANCGAANAATGCAATACGATGTNTTACTTG ANCGTCANCGACAGANTCCGCCCCNGCGTTCTGTTTGGTACCACACCACTGGGTTTGCTGCCCTGTTGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1658055: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16580553073574AA926438TENS1060T. cruzi epimastigote normalized cDNA Library


Date: 6:2:33 on Sun 19 Nov 117.