EST 1658056 is a singleton


Sequence

>1658056 (1 EST) Length=276 GGGGGNTTCTTGNCCTCTTAGGCCNATTTTCGGCACGAGGTTTTTGNGTTCTGCAGGGATGCTGACANAATCCCGAACTG ATACGCACAAATAAAATAGGACAGGAAAGAAAAGGGTCATGGAGAGGCAGCGGCATCGCCACATCCTCAGTGTTTGTCCC AACTACNTCTATATATTCGGATAGGCACTCTCGTGCCACGGTGCGGTGTATTCGGGTTGGAGACATTTATTACTTACGAG TTAAAAAACTTTGGGCCCTCCAGCCACAANACCCCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1658056: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16580563073575AA926439TENS1061T. cruzi epimastigote normalized cDNA Library


Date: 4:24:36 on Wed 22 Nov 117.