EST 1658058 is a singleton


Sequence

>1658058 (1 EST) Length=543 ACGAGGCGACGNGNCANAGAGAATANGAACAAAANCAAAAGGAAAAGAAGAAAGAGAGAAATAAAGAAGAAGAAGAAGAA AAAAAAAACAAGACAAGAAAAAATTAAATCACATGCCAAAACCTCTGCAANAACTGCTTGAAACAAGGCGGGCAATCGAN ATTATTCCAGGANTGCTGTACTTTGCCTCAATGGGGGAGAAATTACTGCCGATTGGGGAGTCTGTCGTCTTTACAAGTCC GTTGCGGTCGGCGTCCGCGCGGTCAATGAAAATCCCGAAGGAGGATCACATTGAGGCTTCTGCCGCTAGCGCCGCACTGG CGGCATCGACCGTTGATTCGTTGGAGGATCGGCCCCCATCGCAAGGGGAGGGACGAGAGTCAAAAACCACCTCACGACGA AAAACGCCTTCGCCGATTATAAATATTTCTCATTTGCGTTCAAATGTACTCAAGCCGTGATTTTACGCCGGCTGATTCTC CTTGGCAACAACGGGGANGAAAATTTTGGGGGTGAAATTGAACNTNGGGCNTTCTACTTCTCN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1658058: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16580583073577AA926441TENS1063T. cruzi epimastigote normalized cDNA Library


Date: 12:6:50 on Fri 24 Nov 117.