EST 1658062 is a singleton


Sequence

>1658062 (1 EST) Length=531 ANTCGGCACGATGAAAAAAAAGAAGCACACATAGAAAAAAATAACTGTTAGATATTATCATGGCACAAACGCGGTCAAAA NCCGCCTTTTACACTCTTTCAGGTAAAGACAAACACACACGCACGCATATACAATCACTGTTTTGCCTCCTTCGTTTCCT CCTCTCTCACATAAACTTTTTTTCCCTTTCTGTTGCACATTGGCTGAAACTGANACTCTTTTGCTTCTTCTTCTTTCTTT TCTTTGTACGCGTATGCATGTGTGTGGTCCTCTGTAGGTGACNAAAAAGCGCTCTGCCTTTCGCCCAAATAGGGCACGCG GCGGCAGAAGANGACGCGGTGGTGGTGTNTCAGCAGCAGCAGATCCATACCAGGCCATGATGGCCCTTATGGGAATGATG GCCGGCGGCGCAATGATGCACCGTAGTAACAAAAGAAGTGGTGGTGGTGGTGGGCCCCGGGGAAAGGGCCCTGGCCCTCT GGAATTTNAACACCCGCTGCANGGCGGTTTCAACCCTTCATTTTCTTTGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1658062: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16580623073581AA926445TENS1067T. cruzi epimastigote normalized cDNA Library


Date: 11:44:14 on Fri 24 Nov 117.