EST 1658065 is a singleton


Sequence

>1658065 (1 EST) Length=399 TTCGAAACNAGGGCCGNAGCCNTTTTTTTTTANTTTTTTCGTCATTTCTTTTTTCCCCTTCAATCCGACCTGCCCTTTTT TCTTCTGTGGGTACGTGTGTGTGTGTGTGTGTNCTTTAGAGCNAAAAGGCCTTTTGTTTCTTTCCTTCCTTCCTTCCTTT TTTTCGTCATTTCTTTTTTCCCCTTCAATCCGACCTGCCCTTTTTTCTTCTGTGGGTACGTGTGTGTGTGTGTGTGTGTG CGGGGGAANGAGTTTGCATGTGGGAATGCNCGCAAAAATGACTTTTTTTTCTTCTCTCCATGCNTTCATTTGAAAGCCGC GTCCCCGCACTTTGGGGAGCGGAGTGATGTCAACTCCAACGCTGAGGGCAAAGGCCCAAATGTTCCATGGANAAAAAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1658065: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16580653073584AA926448TENS1070T. cruzi epimastigote normalized cDNA Library


Date: 10:55:7 on Tue 21 Nov 117.