EST 1658076 is a singleton


Sequence

>1658076 (1 EST) Length=267 GCCNAGGCCANAAATCGGCACNAGGGTCTCGCTCATCCTCCACTGCCCCCCACGCGGAGGGAAAAGTCCGGTCCCTGTAG CTTATGCCTTATGAGCTTTTGAGTTTTAACTGGTGTGGAGGTGTTGGATCAATCTTATCTGAGGTGTGAGGCATGTCGGG TGCAGTGAAACAAATTGTCACATTCCGTTGTTGTACCATTCTCTTTTTTGANAATGGGGAAATAAGGTCTCAGCAAGGCG TATATGCATGGTTTTGCTTTTTTTTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1658076: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16580763073595AA926459TENS1081T. cruzi epimastigote normalized cDNA Library


Date: 7:35:33 on Sat 18 Nov 117.