EST 1658084 is a singleton


Sequence

>1658084 (1 EST) Length=521 ATTCGGCACGAGGGAAAAAAAAAAAAAAAACAGGTGTGGTGGCAGTGGAAAAAAGGGGAGGAAAATTGGTGGTGGGGTGT GAGGGAACCCACCGGTGCCTGTNCCNCCGTGTTTATCAGGTGTTGCATTGCCANCCTAATTGTCGTTGTTGCTCCGGGAG GGCAAAGGCGTTTGTTTNCTTTTGTTTTNCNCATTTATTTNCTTAAATTTTNCTGCAAANATTTGTTTTNGTTTTTGTTT TTTTTTGTTTTTTNCGTTTCCTTTTTCATGTGTTTCTCTCTCTCTCTCTCTCTCCCTCCTTCTCACCTTATATCCTCTTC TCCCCCCTTTTTTTTCTTCATGCCCNCTTTGTTTTTGANTGTATCCNGCCGTGGCTATTAAANTGATCAAAAAACCTCTT ATCTCCTACTGTTCATTTACACTTAAGCACACACACACTTTCTTTCTCCCNCTTTTACTANTTTGGAAAAAAAAAAAAAT NAAGTGGGANAAGAAGANANCCAAGAATTTTGCCNCCNCTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1658084: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16580843073603AA926467TENS1089T. cruzi epimastigote normalized cDNA Library


Date: 6:1:52 on Wed 22 Nov 117.