EST 1658085 is a singleton


Sequence

>1658085 (1 EST) Length=531 ATTCGGCACGAGGGTTTATTCATTCACTGCGTGGTTGCGTGTGCAAATTGCCATCACGTCACGCAAGAAAAAAAGGAAAA AGAAAAAAAAACATTATTGAAGAAAAGGAACTCCCCACTACATGTGTGTTGTAGTGGCTGCTCTCAGCAACCCGACCACT CGCATTTTATCGTAGCATCATTTCACTTTTAAACNACGCCTTGGTTTGATTGGGCGATGTCATTTACTGTGCTGGCCTGC ACGGACATACNTGGGGAGAAGGTTAACGTGGAGCTGCCGTTCAGGGAACCGCCGGCCGCACTTGCTGAACTCTATAGTAC ACTGGAACACGTTTTCCGCGGCGAGGAAAAAGACATCAATACGAAACGGGTCGAAAAATCTACTCGTCCTTCGGANCCGT TTACAGTCAGCCGCGTGCAGANGTATGAAAAAAATACCAGGGGGTGGGTGGAGCTAACGGATGTACAACAACTGCGGGTG CACAATCANTGTTCTTGTTCGCAAGCATGCCACAAAAAATAACTATCGTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1658085: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16580853073604AA926468TENS1090T. cruzi epimastigote normalized cDNA Library


Date: 16:16:4 on Sun 19 Nov 117.