EST 1658106 is a singleton


Sequence

>1658106 (1 EST) Length=411 ANTCGGCACGAGGAGAAGCATCAAAAAGTGTACTGATGTTTCTTGATGTCACCGACCGAAACGCGCTANTTACCTTTGCC GTGGGGAGCGCCAGGTACTCCGATCTTCCACAGGTGCAGTCCGAGGGAGTGAAGTTACTATCGGCGCTTTTGGGTGCANC ACCANAAATCTTTGTGACGGAAGCTAACATGGATGAGGCACCGTTAGGANAAGCTCTTACCGTCTTGGGGTCGGTGGCGT TNATGCATCCCGACGCCAAAACCCGCGTCATTGCGGAACAAGTTTTGGGGGTTTTACANGCGAACTGATGCCTTTTCAAA GGTGTCTGCTTTCAGCGTCCCGGTGCAAATTTATTANGTTCTCTGTTTTTTTTTTTGCCNGGGAAGGGAGAAAAACGTTA TCTATCTGTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1658106: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16581063073625AA926489TENS1111T. cruzi epimastigote normalized cDNA Library


Date: 6:7:47 on Fri 24 Nov 117.