EST 1658108 is a singleton


Sequence

>1658108 (1 EST) Length=531 ATTCGGCACGAGGGTGCAAACNAGCGCGAACTGCCGATCCCGACNACCCCCATTGGATGCGTGGCACAAACGGCTCGCTG CTCTGCAGTGANACGGGTCTCTATTGTTGGAAGTTTGTGAGGCACGGACTGACGCTAGTGTACAGCACGGTGCCGGGGTT TGCCAAGCAGCGATCGCGGAAAAANATGCATGCGACTTTGACTCACGGGAATGGCGGTATTGTTTCCGATAAGCCCGTAA ACTCTGTGGGGGCAAAGAAAAAGGAGTGTGGGAGATCACCGTCCCTGAACCACAGCGGGCCGTTCTTGGCTGTGGGCCGC TCATCTGTCGTGGGATTGTCGAGGAATAGCCTCAGCTTTGAAAATGCCTTTGTTGGAAGCCACTGTGAGTCCCCATCGCA GTGGGGGGCCGCCAGCTACGGANAAGGTGGANACGTCTCTTGCGCACATCTCTCATCGGAACAGGACTTAAAAAACCCCA TACGTTCTTTTAATTCATGCNAATTGANAAACCCGTGCTCTCCCNCCTGNA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1658108: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16581083073627AA926491TENS1113T. cruzi epimastigote normalized cDNA Library


Date: 23:52:12 on Fri 17 Nov 117.