EST 1658110 is a singleton


Sequence

>1658110 (1 EST) Length=534 AANTCNGCACGAGGAAGCCAAACTCAGAATATNCAGCGGTCAACGCCGAGTTTAGAGCCCGAAACAGGAGAAGGTGACGA CGCCGCGTCTAAGGAGCATCAATCCAAACCTCTTTTACGTGTGGCGGTGGTGTCACCGCATGAANAGCATGCTGAGCAGT GTGTANAGGCCGACAANAAAAGGTGCAGCGGTGCGTCTGCTGGAAAANAGGAAGTGAATCGGGAGGAGTTTGCGCCTTCC ATCCGTGAGCCTACCGTCAACGCTTCTGCCACAGCCGCCGCATCTGCAGCTGGGAGTGACNANAAGGGCGATCCCGGCGA CNAGGAAAATGATGGAGCTGGGCGTCAACGTTTTTCCCTTACCAACAGAATGGGGCCGGCGTTCCCGGATTGCCGCAGCT GCAGCTTTTTTTGTGGTACGGACTCGCTTGACTCCATTAACAGCGAAACGATGGTAACTGCCCCAACATTTTCCCTCTGC AACATTGACGGATCCCTCNCCAAANTGCTTCCGAAATTCCCNCGGAAATTTTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1658110: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16581103073629AA926493TENS1115T. cruzi epimastigote normalized cDNA Library


Date: 4:29:21 on Fri 24 Nov 117.