EST 1658121 is a singleton


Sequence

>1658121 (1 EST) Length=535 AATTCGGCACGAGGGTGGATGGTGTTGCCATCCCTTCCGGCCTTGTTCTTGAGTATTTGGCCACGCATCAGGGGGCTAAA TCTGTACTTCATGAATTGCAGCAATTTGAAAAGGAATTGCAAGCCACACGTGCACAGGCTGCAGAGGTTGTGAGTTACGG TGCAAATAACTACGATGAACCTCACCAGGGCCGCGTCTTCACAGCCACGGCTTCACCGCACACGACTATTCTCCCTGTCA CAATGGAGCGAAGACCAAACAACTATAGCGTTCCACATGCAACGCGCGCACCAGCTCCAAGCNAAACCGTCATGGCACGC CTTACCATGATCCAGGCTTCCGAGAGGCAGGGACAGCACGAGGTGCANGCCAGTATTCAAGACGAAAATGAAGCATCCGT TGTCAAGAAGAGACGTGTGGAAGACGAACGAAGGGGAGCGGAATTGTCTCGGAATGATGCGAAAAAGGCNATTTGCNGAC TCCACGGCAAAAATNGGCCCTGGGGGCCCAATTCTTCTTCCCCAAANCTTTCTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1658121: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16581213073640AA926504TENS1126T. cruzi epimastigote normalized cDNA Library


Date: 23:5:26 on Wed 22 Nov 117.