EST 1658139 is a singleton


Sequence

>1658139 (1 EST) Length=546 GTACTATNGCCTTTAATTTTACTTCCGAAAANAATTTCTTTTTTTTTTTTTTGGGCTCAATATATGTGTGATGTACCAAC CCAAATGAGCACGGATAATGGCGCTGCAACANATTTAGGGAATATGACNAATCCTTTGGTCGAACTGGATATTTCGAACA ACGTGTTATTAANTTCTGCTGCGCCAACGGTTTCATTGGAANTGAATGCCATACCTCCCCAATTGGTGAGCCAAATTCCC TTGAAGGAATTGAATGGGGCGGGTGAAAATGAAAATATGANTCAACAANTTGTTGANATAGGGGGANACAATTTGGCAGC AGGAAAATCCGAAAATTCCTCTCATTGTCTCTCTTGCAGGCCCGAGAAGGAAGAAAACACGAGTAGTTCATTAGAAACTA AGCCTCANACAGTTCCCCGTAAGCTTAANAATGCAACGGTTAGTACCCTGACCGAAAACAAATCTTTGCAGCGTATCCGC TCCTGGCTCTTGAACCCCTTTTGTCCANAACCTAAAACAGGATACGACGGAAGAAAATTGTTAAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1658139: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16581393073658AA926522TENS1144T. cruzi epimastigote normalized cDNA Library


Date: 18:57:10 on Sun 19 Nov 117.