EST 1658141 is a singleton


Sequence

>1658141 (1 EST) Length=442 ACGAGGGAGGCNCNNAAATGAAAAAAATNTAACACNCCCCTTAGAANAAGAAATGANCAGGAGAGGAAGGGCACGGAAAA ANTAAAGCAGAGAAAAAAAAAAAGAAATACATATTGAAAAATGAAAGGAGGTGAATGGAGGGCGCTAATTAAATGAATTT AAAAGGGACNAAAAAACACCTAAAANTTGANAGGTACNAAAATTTTTAGTAAAAAAAAAAAGGATAAAGGACNAGGGGAA ATGAAAGGAACAAAAAAGGGTTTTGAATATGGATATCTGTNCACTGGAATAAAAAACACCGGCAACAGTGGCAGAANCAG TACAGGATGGAAGGGATGATACAATTTTTGTGTGCGTGTTGCGTTTTAATTGGACACACAATATAAAAGGCGGGAAAAGA ATGTTTTACCCTGTGAATTCACTTTACCCGGCATTCCCGTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1658141: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16581413073660AA926524TENS1146T. cruzi epimastigote normalized cDNA Library


Date: 0:29:2 on Fri 24 Nov 117.