EST 1658152 is a singleton


Sequence

>1658152 (1 EST) Length=531 TATTCGGCACGAGGGTACTATNTTGTGTTTACCGCCTATTTCTGCACTGCTGCAGAATAATAAAAGGAAAAGCAAAGCAC TGCCAGAGAGAGGATGAGCTACGAGATTCAACCCATAGTGAAGGGTACAAAACGCGACCCGGCGTTAAAACGTTATAACA AGGCGGCAGGAAAAAGTCCGTTTGGCGCTTTCCCTCCCGGCTACGCCCCAAAGAAAACTCGTGCCGATGTCGTGAAATCA CGCGATGAGGAGGAGCCAGTTTCATTGCGTGGGGTTAAGTTTGCCTATCCCGGCACGCGACACGGCTTTGGCGGAGCGAC AAGTTCTCTGTACAAGGGTCGTCCCAACAATACCAACTCCGATGCCTTTTCGACCAATGGTGCGGGTGACAGTAAGCCAC CAAAGGCTGGTGCATTTAANCGTCGTATGATCCCCCCTACTGAATTTCCTCNGTACTATNATCGCGGTGACTGCCGTTAA CCGTATCNCATTGGAACCGNCCCCCTTGACTGGGAANGTNAAAGTGAACCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1658152: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16581523073671AA926535TENS1157T. cruzi epimastigote normalized cDNA Library


Date: 13:4:40 on Sun 19 Nov 117.