EST 1658155 is a singleton


Sequence

>1658155 (1 EST) Length=550 CCTTTCGGAACCAGGCTTCTCCCGCNGCTATGGANGCAATTGACNTCACTGGAGCACATCTTTTTTTTCACAACGGTACA TTGCTGCCGTTACCAATGCTCTCTACACATGACATTGGGTTCGATGANCTGGGGCTTGGCCGAAAGGGAATTGGACCGTT CGCCAAGCCAGTGCCTGACGCCGAATCATTACTTGTTCCACCAGAACAACGTTCAACGGCTTTACACGGCAGTGGCGGGC TTGCATACACTATGCATGTCACTCAGACGCTCAANTCAATGTTGTNTTACCACAAACAGTTACCGTTTTTCCGAAAGGTG ACGGACACGGAGGCGATCAANTCCAAAGAACTCCANCTGAANTACGGCTCTATTTTGAANAACATCTATCGCCTGTNAAG GGACCAAGAAGGCGAGAAAAAATCTCTTACCTGGAAATCACAACGGCTAACATTGGTGATGATGATGANAATGTTANTGG AAGGTTCGATGGANCNAAACAAAGGCGGGTGATTTTTGGTTATNGAACCAAAAAAAAATNGGATGCNTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1658155: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16581553073674AA926538TENS1160T. cruzi epimastigote normalized cDNA Library


Date: 4:28:2 on Mon 20 Nov 117.