EST 1658163 is a singleton


Sequence

>1658163 (1 EST) Length=496 AGGGAAAANGCCCNTGGTGTTTCTCTTGTATCNATGACTCGGAACTGGCTTTGGCGTGCCCCTGACTGTTTGCCCCGCAT GGAGAAGCACAGGAACATCAGGGCCTTTCTCTTAGGGATGCTACGAAAAGTAACNACACCACGCGAGAAGGCACGGATGA CGGCGATGATAACTAAACAAGAGGAGGACCTTAAAGCCATAGANAAGGTTATGGGTATAAAAAATTATTTACTAGGGTCT ACTCCCACCTCATATGACTGCGCCTTGTACGCAGCGTTGCTGCCGTTTATCTCGGAGAAAGAGGATGGACCGGCGGCGTA CGTGAAGAAAAACAAAGTATTCAAAGGCTACATGAAACGCATGTCACACACCACGCCANATGGGCATAAAGGGTTGGATG CCCCCANAATGGGAACTCACCTGAANGGGTTGGTGAAGTTATTTTTATTTTTATTTTTATTTTTTCTTTTCCTTCTTCCT TCTTTATTTTTAAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1658163: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16581633073682AA926546TENS1168T. cruzi epimastigote normalized cDNA Library


Date: 18:11:13 on Fri 17 Nov 117.