EST 1658167 is a singleton


Sequence

>1658167 (1 EST) Length=471 CNTTTTTTTANACAAATGCCCGTCAGCCAACCCGCTGCGCCCCACCCGAATCCGGGACGGTGCGGGTGAAGGCNTCACGG CGGCGGANCGAGCGGCGTCAGGGAAACCGTGAGTGATGGGGGCAGGGCCGCCGCGGCAGCAACNTGGGCGGCGACACCAG CGCACAGGAGGCACGGGAACAACCGCCAGGGCTCGTCCGGCGCCTGTGGGGCGCTGCGCCGTCCCCTCCCCGATGAGGAN TGGGCCACNTTTCCCAAAAAGTTTCAACAAAAGAAGAAGGAACAGTCCTNAAAATATAATGACACATAAAGACTCCCTCC GACACACACAAAAAAATGCTCTTGTTTTTCTTCCACATTGCGANACTTTTTTCACTTCATTGCGTTGGTTTCACTCNACA TTTCTGATCCCAAAAACAAAAAATTANGGGACAAAAAAATCCTGCACCCTGTTGAATTCTCCCAAAAAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1658167: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16581673073686AA926550TENS1172T. cruzi epimastigote normalized cDNA Library


Date: 19:9:49 on Thu 23 Nov 117.