EST 1658187 is a singleton


Sequence

>1658187 (1 EST) Length=532 CTCGGAGGCCGATTAATCAAGCACGAGGTTTTGTTNTTTTTNTTTCATCTCACATATTCTCCAAAGCCTTTTAGTACTTC GCTGCATCCTCCGCAAAGGCGGCGTGGTCCGTCGGCAATGTCTTCCAGCCCATAGCGAGGCCTTCATCCTTGTTGCGCTT CGGGATNATGTGAAAGTGCACATGCGGCACCTCCTGGTGGGCAANTTTGCCGTTGTTCTGCAGCACGTTGTACTGCGTCT TTGGTTCTCCCTCCCCAGCCACAACACGGGCTATCTTTGCCATCATCACCCCCAANTCAGCCGCCGTCTCCGGCTCCACT TGGTGAAAAAACTCTGCGTGGGTCTTTGGAACAATCANCAGGTGGCCGCGGGANANGGGGTTGATNTCCACAAAGGCCAA CACCCTTGTCGTCTCCGCCACCCTGTGGCACGGGATGGAACAGCGGCCGCAAGCTTATTCCCTTTAATGAAGGTTAATTT TAACTTGGCACTGGCCGTCNTTTTACAACTCCTGAAATGGGGAAAAACCCGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1658187: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16581873073706AA926570TENS1192T. cruzi epimastigote normalized cDNA Library


Date: 9:41:20 on Fri 24 Nov 117.