EST 1658239 is a singleton


Sequence

>1658239 (1 EST) Length=544 CTCGAGGGNAGATTCGGNACGAGGCCGCAACTTTTTTTTTTTTTTTTTTTCAACAACAATAAAAATAAAAAAAAAATGCT CCTTGCCAGTGCCCTGTTCCTCACAATCCCACAGTTACTATTACTGTTATTCTCTCTCCTCAGGCACCCACAGGCACGCC ACAATCAGTTCAACACGCGCCCCTCCAGCACACGCCGCTGCCATACGCTCCCGTTGCGCCGCAAAGTCCACCAGCTCCTA CCAGTCAAACGGNTCCGTGTCCTATACAATCGCCAGCATGCCCCGGCCGCGCAACACACACAGCGCCACAATGTCNTGCC GCCCCCCCTCCCCAATAGTGAGCGCAACGCCAAACGCNTANCGGCGCACGCGCCCCACGCGCTGCAACCACAAGCCGATC AGGTTGGCCGTCATCAACTGCGTCTCGTTTTCCTCCTTCAGCAAACCCTCTCACCCTCTCAATCCACGGTCTGGGTGCCA TGAAGGGACNTTAANCAANGCGCCNCCTCTGTGGAAAAANTCAAATTGCTTGAAGAATCCGGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1658239: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16582393073758AA926622TENS1244T. cruzi epimastigote normalized cDNA Library


Date: 15:26:16 on Thu 23 Nov 117.