EST 1662902 is a singleton


Sequence

>1662902 (1 EST) Length=134 AAATTATATAGATGCAATGCCTAATCAACATTCTACCGCAAAACCAACAAAATCAATCCCTCAATTAACAAAAGAATGAT ATTAAAAAACAACAAAAACCACACAATTCCTAAGATCGTAACGTTAAGAATGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1662902: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16629023080327AA931018SMTBADA000072SKSchistosoma Lambda Zap II


Date: 14:36:16 on Fri 17 Nov 117.