EST 1662903 is a singleton


Sequence

>1662903 (1 EST) Length=111 ATCAAAATTTTGCCGATTTTACGATAGTCTAGTATTATTGGCTGCTATTGTCAAAAGATTAAGTGTAAAGCCGTATTGAA TTTTCTGTGAAATAAAATGTGCTGGAACTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1662903: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16629033080328AA931019SMTBADA00077SKSchistosoma Lambda Zap II


Date: 6:17:34 on Fri 24 Nov 117.