EST 1662912 is a singleton


Sequence

>1662912 (1 EST) Length=156 AGTCATACTTGCTACAAAAGACGATATTGTTCCTAAGGTACCTGCAGCTGCTCCACAGTTAGTAAAGAAGAAGGAATCTA AGAAAAAGATAAAGAAACAACTAATGAAGGAGAGTGCTGGTTTTTAATTATCTAAATATATATGGTGGTAATTTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1662912: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16629123080337AA931028SMTBADA000191SKSchistosoma Lambda Zap II


Date: 1:8:50 on Tue 21 Nov 117.