EST 1662913 is a singleton


Sequence

>1662913 (1 EST) Length=135 TGTTTGATCATTTCAGTGAATTTTTCACATGGGTTTTTCAACTACTTATTCACTATAGTAGTTGGATTGACAATTAAATT TAATTCGTAACCGTATATATATTGCCTTGTAAATCATTTATATCAATGTATATAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1662913: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16629133080338AA931029SMTBADA000194SKSchistosoma Lambda Zap II


Date: 4:31:30 on Thu 23 Nov 117.