EST 1662917 is a singleton


Sequence

>1662917 (1 EST) Length=165 AATGTACAGCTATTATTTTTATATTTAATGTATGTTTAAAACTGGTTCGAAACTATGAATCTTTCCTTAAAAATTTATAT TCTGTAGAATAATTTTCAGCTTGAAACAAACCATCACTATTTTGGAAGAAATAACGGCGATCGGTTAACGTTCATTCTTA AGTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1662917: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16629173080342AA931033SMTBADA000205SKSchistosoma Lambda Zap II


Date: 18:15:9 on Fri 17 Nov 117.