EST 1662921 is a singleton


Sequence

>1662921 (1 EST) Length=187 CTACGATAGCCTGCGTCTTGTTGGGCAACGTCAATGCTCTTTTCATGGTGTCAGCGCACTTAACGGGGATGGAATAAACA GCAGTATCAAGTGGATGTCAGATAAGGTTAAAGGCAAGCCTAAACAAAGGCCACCAAAACAGCTTGAAATCCCATAAGTG CTCGTTGTAAAACATGTTTGTTTGTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1662921: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16629213080346AA931037SMTBADA000213SKSchistosoma Lambda Zap II


Date: 6:17:51 on Thu 23 Nov 117.