EST 1662923 is a singleton


Sequence

>1662923 (1 EST) Length=145 GCTCAGTTGAAGTACTCTCCAAGGATATACATAGTTTTGCGTAGTTGTATCATTCGTTCAAGTTTAAGTGTGAATACATG TATACTAATCTGAAATGTATGTACATGTATTTACAGCATATTTTTGTGCATATTTTGTGTCGATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1662923: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16629233080348AA931039SMTBADA000218SKSchistosoma Lambda Zap II


Date: 14:26:17 on Tue 21 Nov 117.