EST 1671595 is a singleton


Sequence

>1671595 (1 EST) Length=118 CTTTTGTCCGTTATACTTGACTGTATTACATTCACCACGTCAACCTAGTTTGATCACGTTGTCTGATTTAATTTTAATTC AGACCTAACATAAGATATACATATAATACCTCAAGAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1671595: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16715953096899AA938788SMTBADA000545SKSchistosoma Lambda Zap II


Date: 13:52:16 on Thu 23 Nov 117.