EST 1671596 is a singleton


Sequence

>1671596 (1 EST) Length=226 CCGGCGCACAACGGAAGGCTTTTTCTGCACTCTCTCACGCTCTCTTAACTACTACTCTACTCACTGAGTGAATAGTGTAT GATGACTCTGTTATGTAATCATCTGGATAACGTACGTAGTTGAGTTGATTAGACCAATGATGTTGACCAATAATAAGGTT AGAACGCAAACTGGAGAATTTAAGAAATGTGCGGAACGAAATCAAGACGAAGACGTGGAAATGTCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1671596: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16715963096900AA938789SMTBADA000546SKSchistosoma Lambda Zap II


Date: 0:43:36 on Thu 23 Nov 117.